CX308577

Overview
NameCX308577
Unique NameCX308577
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length439
Libraries
Library NameType
AbsLeaSub1cdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
Properties
Property NameValue
Genbank descriptionC21001E04Rv AbsLeaSub1 Citrus clementina cDNA clone C21001E04, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CX308577 ID=CX308577|Name=CX308577|organism=Citrus clementina|type=EST|length=439bp
TATAAGCAGTTGGTTTCGATTGACAAGGACCATCACACGGTTTTGCTTCA
ATTAATCTTCATTTTCCCATTATTATTATATTAATTCTTCCTCTAGTGTT
GTTCAAACTCCCCCTTCCCCACCTTTTTATCATTGGGTTATTTAATTTTA
TGATTGAACAGACGGAAACTGGGTTTATAAGAGTCGCGAATGAAGGAAAT
GGATATAATATTCGTGTGGCAAATGGATGCGACAGTGGCGATAGGCCTGT
TTACAAAAGCAACCCTGCAACAAATGACTGGATTCCCAGTGTCGAATACG
ATCAGGGATTCATCTCTTCCAAGCCGAATCGGAGCGAGGGCTGTTAGATA
TGTGACTTGTAAAAAAGACGTGTTCTTCAAATTTGATGAGGTTGTGGGTT
TAGTGATTTTGGTGTGAATGGAATTAATGTGCTTTTACT
back to top