CX308584

Overview
NameCX308584
Unique NameCX308584
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length422
Libraries
Library NameType
AbsLeaSub1cdna_library
Properties
Property NameValue
Genbank descriptionC21001E11Rv AbsLeaSub1 Citrus clementina cDNA clone C21001E11, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CX308584 ID=CX308584|Name=CX308584|organism=Citrus clementina|type=EST|length=422bp
ACACAAACCAAAGGGCCACATACTAATTCTTTCATTCGAAGAGAATACAG
TATTAATGCCGACACTTGTTGATACCAAAATTTACTGACATATTCAAAGC
AACGAGTGATAGAATTAACTATGCTAATTAAACATTCTAAATATTATCCT
GAAATGTGCATCTCAAATGAGTGAAGTAACATTTATTAAGTGGACGGTGA
TGTTGAACATTTTTTAATACCCCATTTTCCCATCCACAATATTGAAGCAC
ATCAATGAGGACGCATCTTCTTGGGATAAATTATTGGAAAGGCTAACATG
CCTCTCAAGTTTTATTTCTTAATAATTGTCTTATCTTAGTGATCATCCAA
TTTTCGTCAAGGAAACTGTCACGTTGATAAACTTAGTCTTTTCCTTAGAC
ATGCGATCGGCAACAATTTCCC
back to top