CX308588

Overview
NameCX308588
Unique NameCX308588
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length662
Libraries
Library NameType
AbsLeaSub1cdna_library
Properties
Property NameValue
Genbank descriptionC21001F03Rv AbsLeaSub1 Citrus clementina cDNA clone C21001F03, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CX308588 ID=CX308588|Name=CX308588|organism=Citrus clementina|type=EST|length=662bp
GATATTTAATGACAAAATATCTCCTCTGTTTAAAAAGGTATTCTGGTTGT
TTTATTGAATTTTTGGGCAATAGGATGTTGTTCCTGGTGAATCTTATGTA
TAATTTGTGAATTAGCTCAATACAATGACTAGTTTTCATCAAAAAAAAAA
AAAAAAAAAAAAAAAGTACGCGGCAGGCTATGTATGTATAAGTGTCTTCA
GGTTTTCAGATTAAGCTTTGGCGATCTTGGGAGCTTCAGGCAGGTTCCTT
GAAGTGCTTGTCTGTTGGCTTTCTATAAGATTCATGCTTGATGTTGATGG
TTCATGGAATCACATTGATGGGTGATGGTTATCCAAACACAAGATCCAAG
TCCTATTGTTCTCAGACTTAATCTTTGATTTTCAGTTGCTTCAGCAACAT
AAGCTCGCAACCACAGGTTTTAAGCTTTGGCGATCTTGGTTCAGCGCTTA
CTTGAACACAACCTTCAAGCAGTCAGGATCATAAATTTGAAAAATGCTTC
TCATTCCGTTGCATTGAACGAACACCATGAGCATCAAACTCGAGAACGAG
TGAGATTGACGCTATCTTTTAATATCTTTTAACACCTTGGCAGAGAATTG
TTCCCAGGCTTATTACATTAAGCCTGAGCTAACCCTCTGAGCACTGTAAT
TGGAGCTGAAGG
back to top