CX308594

Overview
NameCX308594
Unique NameCX308594
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length209
Libraries
Library NameType
AbsLeaSub1cdna_library
Alignments
Feature NameTypeLocationAnalysis
Ccv1_Contig10073 contig Ccv1_Contig10073:562..770. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionC21001F09Rv AbsLeaSub1 Citrus clementina cDNA clone C21001F09, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CX308594 ID=CX308594|Name=CX308594|organism=Citrus clementina|type=EST|length=209bp
TTTTTTTTTTTTTTTTTTTTTTTTTTTATCAACGCGCACAAAAAATAAAC
ACTAATAAATGGAATTATTTTTGTCAACAGCTCAAATGATACAAATCGTA
TCGACAAAAATCGCTAACCCAATGAAATCTTCAGGAGGAGCTACGATCTA
AATGTAGAACTTCACTAAAAGCTCAAAGCCCATCAGGCTCAAGTTTTCAT
AGGTAGTGA
back to top