CX308595

Overview
NameCX308595
Unique NameCX308595
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length256
Libraries
Library NameType
AbsLeaSub1cdna_library
Alignments
Feature NameTypeLocationAnalysis
Ccv1_Contig946 contig Ccv1_Contig946:1..256. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionC21001F10Rv AbsLeaSub1 Citrus clementina cDNA clone C21001F10, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CX308595 ID=CX308595|Name=CX308595|organism=Citrus clementina|type=EST|length=256bp
GCCATTGCACTGCAATATGAACCTGAAGAAATGTTATTTTGCCAATTCAA
TCGGCTGGTTGTTACCATGCACAATATGAGTGTATTTTGTTTCTTATAAA
ACAGAATCTGAGTAAATAGATAAACAATGACAAGAATAGGCTTTGTGATG
ATACAAGTAATATCTTCAATACATTTATCAAAGTCAATTTCAATGTGGTG
ATTAATCAAGCTCTAATGATCAAAATTTTTTAGCACAAATATCTATACAA
TTACAA
back to top