CX308854

Overview
NameCX308854
Unique NameCX308854
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length303
Libraries
Library NameType
AbsLeaSub1cdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
Ccv1_Contig8267 contig Ccv1_Contig8267:1141..1443. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionC21004F02Rv AbsLeaSub1 Citrus clementina cDNA clone C21004F02, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CX308854 ID=CX308854|Name=CX308854|organism=Citrus clementina|type=EST|length=303bp
TGTGGTTGACTCTGGGCTTTCCTTTGAAGAGAAGTGGCAAAAAGCTCTGG
CTTCGTCACTGTTTGCAAACACGATGTCGGCATAGTTTCCAACAATTTCC
CAGAAGTCATCATAATGTCTCTCAATGCACGTCACATCTGATGCTGTTAC
TGCAACCAGAGCGCCACTTCTGTGAGCTACTTCACAAGCTTTTGTAATTG
TTCTAATTGTATCAGGAAGTTCAAACAAATAGCCTTCAACAATAAATATA
TTTGTCTTGGAAATAAGGTTAACCAAGCAGGGATCATAGTTGATAGTCGA
TGA
back to top