CX308855

Overview
NameCX308855
Unique NameCX308855
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length385
Libraries
Library NameType
AbsLeaSub1cdna_library
Properties
Property NameValue
Genbank descriptionC21004F03Rv AbsLeaSub1 Citrus clementina cDNA clone C21004F03, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CX308855 ID=CX308855|Name=CX308855|organism=Citrus clementina|type=EST|length=385bp
TTAATTGACTCCTTTGCCAAATCATCGTTCAACCACAAAATGTGCTGACA
AATATTCTCCTCATCTTAAACTAGATACAGCAAAATTTCTTTGTAAAATG
AAATACAGTAAGCCTGACAATGCATCAGTTATGATCTAATGAATAGTCAG
ATCCTAATTATTTTTATTCAAAATTTATTAAAAAAAAAATTCTCTTCATC
ACGCAAAATTGATCCGCATGCACCTTTTACATGCAAAGAATGGCAACACT
TACTATTAAAAATACAGTAGTATGCAATAATTTATGCAGCAGCAGACTGC
TTTTCCTCATACTCATCAAGATTTAGAGCTTCCAACAACTTTGGCCAGGA
TTCTGGGATTCCTCCGGGTAAATCGAATTCCCCCG
back to top