DY257718

Overview
NameDY257718
Unique NameDY257718
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length175
Libraries
Library NameType
AbsCOv1cdna_library
Properties
Property NameValue
Genbank descriptionKN0AAB1AC10ZM1 AbsCOv1 Citrus clementina cDNA 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>DY257718 ID=DY257718|Name=DY257718|organism=Citrus clementina|type=EST|length=175bp
TTCTTTTTTTCGGGACCCGGCGTTGTGGTAGGGCCCGAGGAATTCCGGCA
TTACGGGGGGGGCGGCTTCATGTTTTTTTGTTCTGGCAGTTGCTGAAGTT
TTTTCATTGACCGAAGATAATTTAATGGAAAAGGAGCTCTCATTTTTTTT
TATTAAAATAATACAAATTTATGTT
back to top