DY257723

Overview
NameDY257723
Unique NameDY257723
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length313
Libraries
Library NameType
AbsCOv1cdna_library
Alignments
Feature NameTypeLocationAnalysis
Ccv1_Contig9894 contig Ccv1_Contig9894:4..316. Citrus clementina Unigene version 1.0 (Ccv1)
Properties
Property NameValue
Genbank descriptionKN0AAB1AD04ZM1 AbsCOv1 Citrus clementina cDNA 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>DY257723 ID=DY257723|Name=DY257723|organism=Citrus clementina|type=EST|length=313bp
GGCATGGGCCTTGAACTCTATTACAGCTAAATCCACCGTTAAATATATAT
GCTGCTGCAAGCAGTCAATACTACTAGGAACCATATGCTATAATAAGCAA
GGGGTATTGGAAGATGCGGCAGGGCCAACTTTACTAATACTGTCTTGTAA
GAAAAAATTTGTGAAGACTCGTAAAAACTTATTTGTGGTTATGTAACATA
TCTGGGATCTGGACTTACTCTCCATTTTGAATGGTGTTTAGATCCTTATC
AAGGTATTGAGGTACCACATGCTTGTCAGTCCATTAGGCTGATAGAATTT
TGTGAAAAAAAAA
back to top