DY257732

Overview
NameDY257732
Unique NameDY257732
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length506
Libraries
Library NameType
AbsCOv1cdna_library
Alignments
Feature NameTypeLocationAnalysis
Ccv1_Contig539 contig Ccv1_Contig539:18..525. Citrus clementina Unigene version 1.0 (Ccv1)
Properties
Property NameValue
Genbank descriptionKN0AAB1AF06ZM1 AbsCOv1 Citrus clementina cDNA 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>DY257732 ID=DY257732|Name=DY257732|organism=Citrus clementina|type=EST|length=506bp
AGGGCTCAAGCACAACTACTTACCTTTTGAGTTTTGAATACGGTTCAGTC
GAAGCCAGCAGAAATCGTTTGCCTTCCTGATTTGAAGATTATGGGAACTC
CTTGCGCAGGTTTATACATAGGCCATCCATTTTCAAATAAATGTCATTTA
TAATTCTTATTTTAATATGTGTATTTGTGATTAAGTTTTATAACATGAAT
TTTTCAGGTTATACCGATTGGTCGGAGGGGCTTATAGCCACAACTTTTTC
ACTTATTGCTGATGATGAAATTAATGGAAATATTGATCTTCTTGTGGTCC
CGCAATATGGAAGAAACCCTAATCACACTGGTTAAGAATATGCAGTATTA
GTCTCTTATGTTATGTTTAAGAAAATAAAAGTATGGGTACTGTTATTACC
CGTCAATTGTATGATGGTCTCAATTTGGTTCAATTTAACTTGTAAGATCT
CTTGATATATATAAGAGATTCTCTTTGTCTAGCTATTTATGTGTACCATG
TTTTCC
back to top