CiBE4825, CiBE4825 (genetic_marker) Citrus spp. | Citrus Genome Database

Marker Overview

Marker Overview


Name	CiBE4825
Genbank ID	N/A
Type	SSR
Species	Citrus spp.
Repeat Motif	(TTATT)4
Primer 1	CiBE4825.Forward Primer: ATAAGTGGAAAGAGGTATCGG
Primer 2	CiBE4825.Reverse Primer: GAACACCAAGCATCAAGAC
Publication	[view all]
Contact	Yong-Sham Kwon

Contact

Name

Details

Yong-Sham Kwon

First name:	Yong-Sham
Last name:	Kwon
Title:	Researcher
Institution:	Dong-A University
Address:	Department of Genetic Engineering, College of Natural Resources and Life Science, Dong-A University, Busan 49315, Korea
Country:	Korea
Email:	yskwon3@dau.ac.kr

Publications


Year	Publication
2016	Hong JH, Chae CW, Choi KJ, Kwon YS. A database of simple sequence repeats (SSR) marker based DNA profiles of Citrus and related cultivars and germplasm. Korean Journal of Horticultural Science and Technology. 2016; 34(1):142-153.

Map Positions


#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	Citrus-Fina_Sodea/Byungkyool-F1-Byungkyool	B04	N/A	42	CiBE4825	View
2	Citrus-Okitsu46/Okitsu56-F1	LG08	N/A	19.2	CiBE4825	View