|
Marker Overview
Name | LCYE200 |
Genbank ID | N/A |
Type | CAPS |
Species | Citrus spp. |
Primer 1 | LCYE200.Forward Primer: CCCATCTTGATTGGTCGTGCT |
Primer 2 | LCYE200.Reverse Primer: TCCCTGATGCTGCTCCAGAA |
Publication | [view all] |
Contact | Xiuxin Deng
|
Publications
Year | Publication |
2011 | Cao H, Biswas MK, Lü Y, Amar MH, Tong Z, Xu Q, Xu J, Guo W, Deng X. Doubled haploid callus lines of Valencia sweet orange recovered from anther culture. Plant cell, tissue, and organ culture. 2011; 104(3):415-423. |
|