|
Marker Overview
Name | Gn0014 |
Genbank ID | AB114653 |
Type | STS |
Species | Citrus spp. |
Primer 1 | Gn0014.Forward Primer: TTGCTGCCGTCATGTCTAGTT |
Primer 2 | Gn0014.Reverse Primer: CCGGAAATAAGGCACGTC |
Product Length | 1000 |
Publication | [view all] |
Contact | Mitsuo Omura S. Ohta
|
Publications
Year | Publication |
2014 | Shimada T, Fujii H, Endo T, Ueda T, Sugiyama A, Nakano M, Kita M, Yoshioka T, Shimizu T, Nesumi H, Ikoma Y, Moriguchi T, Omura M. Construction of a citrus framework genetic map anchored by 708 gene-based markers. Tree genetics & genomes. 2014; 10(4):1001-1013. |
2016 | Karas PA, Perruchon C, Karanasios E, Papadopoulou ES, Manthou E, Sitra S, Ehaliotis C, Karpouzas DG. Integrated biodepuration of pesticide-contaminated wastewaters from the fruit-packaging industry using biobeds: Bioaugmentation, risk assessment and optimized management. Journal of hazardous materials. 2016 Jul 30. |
|